Goals:
- Understand the power of regular expressions.
- Understand the things that sed can do with expressions.
- Change the format of real data from biological experiments using regular expressions.
Regular expressions (regex) and more sed
In the last discussion we learned that sed can be used to
replace characters with a tab - e.g.sed.
What you were doing was using regular expressions (regex) - searching for and matching a specific string(s)
of characters- and replacing the regular
expression with with the desired character using sed.
You can also do this with awk and grep and a million
(might be an exaggeration) other commands and programming languages.
Note: regex can vary slightly between commands and programming languages.
Today we will learn more about regex using sed. <- that link leads to an amazing sed tutorial. The website has late 90’s style, but the info is really very good.
Letters:
With sed we can replace or delete some characters. Lets supose we have
the expression Pp132 and we want to print only numbers 123. We could do the
job just by replacing the letter with noting. Like this:
[c177-t0@n9917 ~]$ echo "Pp132" | sed 's/[P][p]//'
123
In the code above [ ] means a single character. Also,
because we used sed and we added nothing to replace
the match pattern we only returned 132.
The code above worked for that particular expresion but wont do the job for other
expressions like Bb132 or this Aa123 or Dd123,etc.
[c177-t0@n9917 ~]$ echo "Bb132" | sed 's/[P][p]//'
Bb132
[c177-t0@n9917 ~]$ echo "Aa132" | sed 's/[P][p]//'
Aa132
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[P][p]//'
Dd132
This is were regex become a poweful tool. Using regex we can specify that we only want to match lowercase letters [a-z], uppercase letters [A-Z] or both upper and lowercase letters [a-zA-Z]. Thefore, we can use a single command that works with diferent inputs.
[c177-t0@n9917 ~]$ echo "Bb132" | sed 's/[A-Za-z][A-Za-z]//'
132
[c177-t0@n9917 ~]$ echo "Aa132" | sed 's/[A-Za-z][A-Za-z]//'
132
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[A-Za-z][A-Za-z]//'
132
In regex the & means the characters that were matched. We can try this instead
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[A-Za-z][A-Za-z]/&/'
Dd132
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[A-Za-z][A-Za-z]/&&&/'
DdDdDd132
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[A-Za-z][A-Za-z]/&\t&\t&/'
Dd Dd Dd132
The tab \t does not always work in sed regular expressions! If you cannot make it work try the following '$'\t in place of \t
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[A-Za-z][A-Za-z]/&'$'\t&'$'\t&/'
Dd Dd Dd132
What happens if we do the following:
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[AZaz][AZaz]//'
Dd132
Nothing… because we matched only AZaz. The - tells regex that you are looking for a range of characters from A-Z or a-z. When you ommit - that will tell regex to look
only for the characters in the [ ] which in this case are A , Z ,a and z.
Numbers
Let’s try the same with numbers. We will add a tab after the letters and repeat the pattern 2 times:
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[0-9][0-9][0-9]/\t&&/'
Dd 132
We can also match just the first number but not replace it. In other words, we can delete the first number
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[0-9]//'
Dd32
If we do the following:
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[023]//'
Dd12
We only have the 3 replaced, why?
Well is was the first number that matched [023]. If we do this we replace both the 3 and the 2.
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/[023][023]//'
Dd1
We can use the . as a wild card for any character.
Let’s matched the D with a wildcard. Since . will macth the first character we can type:
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/.//'
d132
Here will match D and d.
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/..//'
132
There is way to search for multiple characters that match a pattern and that
is with . followed by a *.
[c177-t0@n9917 ~]$ echo "Dd132" | sed 's/.*//'
What * is doing above is matching all . until it finds the end of a line. Thefore, all characters
were matched and replaced.
If you want use regex for an actual period you need to use the escape \. For example:
[c177-t0@n9917 ~]$ echo "Dd.132" | sed 's/.*\.//'
123
The .* search ended at the . We can grab both sides of the match with:
[c177-t0@n9917 ~]$ echo "Dd.132" | sed 's/.*\..*//'
Anchor your regular expressions with ^ and $
^ means that you are looking for only a match at the beginning of the line. For example:
echo "Dd.132" | sed 's/^.*\.//'
c132
vs
[c177-t0@n9917 ~]$ echo "Dd.132" | sed 's/\..*$//'
Dd
Keeping part of the pattern (different than &)
If you have a phrase like “African wild dogs rule” you can use regex to rearrange the phrase to “wild dogs rule Africa” using escaped ().
[c177-t0@n9917 ~]$ echo "African wild dogs rule" | sed 's/\(Africa\)n \(wild dogs rule\)/\2 \1/'
wild dogs rule Africa
In this case we used \( and \) around the text that we wanted to keep.
We then called them using \1 and \2. If we want to keep the phrase “wild dogs rule”
we could do the following:
[c177-t0@n9917 ~]$ echo "African wild dogs rule" | sed 's/\(Africa\)n \(wild dogs rule\)/\2/'
wild dogs rule
Mini-challenge
In a file called Week4_mini-challenge<your.initials>.sh save the
echo and sed commands that give you the following Input and Output combinations:
-
Input: Cats eat 5 billion birds a year
Output: 5 billion? 5 billion!
note: white spaces are single spaces -
Input: 12345abcde678910fghij
Output: abcdefghij12345678910 -
Input: 12345abcde678910fghij
Output: ab cd ef gh ij 12 34 56 78 91 0
note: white spaces are tabs
4. Input: 12345abcde678910fghij Output: ab cd ef gh ij note: white spaces are tabs
To SUBMIT your Mini-challenge, push your file Week4_mini-challenge<your.initials>.sh to this Github
repository
Note:replace <your_initials> with your actual name
Sed again…
You can use multiple sed commands at the same time.
[c177-t0@n9917 ~] echo "dogs1cats1dogs2cats2" | sed 's/dogs1//' | sed 's/cats2//'
cats1dogs2
or you can use the -e flag
[c177-t0@n9917 ~]$ echo "dogs1cats1dogs2cats2" | sed -e 's/dogs1//' -e 's/cats2//'
cats1dogs2
You also learned last time that you can replace multiple instances of a match using the global replacement as follows:
[c177-t0@n9917 ~]$ echo "dogs1cats1dogs2cats2" | sed -e 's/dogs/sgod/g' -e 's/cats/stac/g'
sgod1stac1sgod2stac2
When using global replacement you might also find it useful to use
anchors for your regular expressions. ^ anchors your search to
the beginning of the file. $ anchors your search to the end of the file.
[c177-t0@n9917 ~]$ echo "dogs1cats1dogs2cats2" | sed -e 's/^dogs/sgod/g' -e 's/cats/stac/g'
sgod1stac1dogs2stac2
notice that the second instance of dog was not modified.
[c177-t0@n9917 ~]$ echo "dogs1cats1dogs2cats2" | sed -e 's/2$/two/g'
dogs1cats1dogs2catstwo
notice that only the 2 at the end was changed to two
Challenge
You are given a DNA sequence file in fasta format. It has the following features:
>gi_EU254776;tax=d:Fungi,p:Ascomycota,c:Sordariomycetes,o:Diaporthales,f:Gnomoniaceae,g:Gnomonia;
TCATTGCTGGAACAAACGCCCTCACGGGTGCTGCCCAGAAACCCTTTGTGAATACTACCTAAAATGTTGCCTCGGCAGTG
>gi_FJ711636;tax=d:Fungi,p:Basidiomycota,c:Agaricomycetes,o:Agaricales,f:Marasmiaceae,g:Armillaria;
GGAAGGATCATTATTGAAACTTGAATCGTAGCATTGAGAGCTGTTGCTGACCTGTTAAAGGTATGTGCACGCTCAAAGTG
- The
>followed by text indicates the name and information for a DNA sequence
* In this case, the read name is the alpha-numeric following the>gi_. The taxonomic ranks for the thing sequenced are indicated by the letter d = domain, p = phylum, c = class, o = order, f = family, and g = genus. - The following line of AGTCs indicate the DNA sequence
- In the example above, you are given 2 DNA sequences.
For this challenge, you want to extract the taxonomic information for each read in a specific format and you do not want to include the DNA sequences. The specific format that you need resembles the following:
EU254776 Fungi;Ascomycota;Sordariomycetes;Diaporthales;Gnomoniaceae;Gnomonia
FJ711636 Fungi;Basidiomycota;Agaricomycetes;Agaricales;Marasmiaceae
*Note: Spaces above refers to tabs
For this challenge you will need to do the following:
- make a copy of the data file
~/classdata/Labs/Lab4/rdp_its.90_test.fastaand put it into a new directory in your home for Lab_4. - Grab only the lines of the
rdp_its.90_test.fastafile that include the sequence name (hint you will probably not want to use sed). - Use sed to reformat each line so that it resembles the specific format indicated above (hint not all of the lines will have six taxonomic ranks).
- Save the information with the format indicated as
challenge_regex_sed_<your_initials>.txt - To SUBMIT your challenge
pushyour filechallenge_regex_sed_<your_initials>.txtto this Github repository
Note:replace<your_initials>with your actual name